Cell Culture:Article Title: Mycobacterium bovis induces macrophage mitochondrial release of hexokinase 2 to enhance intracellular survival.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER VBIT-4 Targetmol Cat#: 2086257-77-2 EGS ThermoFisher Scientific Cat#: 21565 1.5M Tris-Hcl (ph8.8) Solarbio Cat#: T1010 1.0M Tris-Hcl (ph6.8) Solarbio Cat#: T1020 FITC Solarbio Cat#: F8070 Mutanolysin Sigma Cat#: SAE0092 OADC Becton, Dickinson, and Company Cat#: 212351 Experimental models: Cell lines BMDMs This paper N/A RAW264.7 cell Cell Culture Center, Xiehe Medical University Cat#: 1101MOU-PUMC000146 Experimental models: Organisms/strains C57BL6/J SpfBiotech N/A Oligonucleotides mtDloop-2-fwd: AATCTACCATGCTC CGTGAAACC Tsingke N/A mtDloop-2-rev: TCAGTTTAGCTACCCC CAAGTTTAA Tsingke N/A β-actin-fwd: CCTTCTGACCCATTCCCACC Tsingke N/A β-actin-rev: GCTTCTTTGCAGCTCCTTCG Tsingke N/A Recombinant DNA PET-(28a+)-ESAT6 This paper N/A Software and algorithms FlowJo version 10.2 BD Biosciences https://docs.flowjo.com/flowjo/getting- acquainted/10-2-release-notes/ NIS-Elements Viewer 5.21 64-bit Nikon https://www.microscope.healthcare.nikon. com/products/software/nis-elements/ software-resources GraphPad Prism 8 GraphPad https://www.graphpad.com/features ImageJ NIH N/A 16 Cell Reports 44, 116421, October 28, 2025 We used RAW264.7 in the present experiments were obtained from Cell Culture Center, Xiehe Medical University (Beijing China). ..
Recombinant:Article Title: Mycobacterium bovis induces macrophage mitochondrial release of hexokinase 2 to enhance intracellular survival.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER VBIT-4 Targetmol Cat#: 2086257-77-2 EGS ThermoFisher Scientific Cat#: 21565 1.5M Tris-Hcl (ph8.8) Solarbio Cat#: T1010 1.0M Tris-Hcl (ph6.8) Solarbio Cat#: T1020 FITC Solarbio Cat#: F8070 Mutanolysin Sigma Cat#: SAE0092 OADC Becton, Dickinson, and Company Cat#: 212351 Experimental models: Cell lines BMDMs This paper N/A RAW264.7 cell Cell Culture Center, Xiehe Medical University Cat#: 1101MOU-PUMC000146 Experimental models: Organisms/strains C57BL6/J SpfBiotech N/A Oligonucleotides mtDloop-2-fwd: AATCTACCATGCTC CGTGAAACC Tsingke N/A mtDloop-2-rev: TCAGTTTAGCTACCCC CAAGTTTAA Tsingke N/A β-actin-fwd: CCTTCTGACCCATTCCCACC Tsingke N/A β-actin-rev: GCTTCTTTGCAGCTCCTTCG Tsingke N/A Recombinant DNA PET-(28a+)-ESAT6 This paper N/A Software and algorithms FlowJo version 10.2 BD Biosciences https://docs.flowjo.com/flowjo/getting- acquainted/10-2-release-notes/ NIS-Elements Viewer 5.21 64-bit Nikon https://www.microscope.healthcare.nikon. com/products/software/nis-elements/ software-resources GraphPad Prism 8 GraphPad https://www.graphpad.com/features ImageJ NIH N/A 16 Cell Reports 44, 116421, October 28, 2025 We used RAW264.7 in the present experiments were obtained from Cell Culture Center, Xiehe Medical University (Beijing China). ..
Positron Emission Tomography:Article Title: Mycobacterium bovis induces macrophage mitochondrial release of hexokinase 2 to enhance intracellular survival.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER VBIT-4 Targetmol Cat#: 2086257-77-2 EGS ThermoFisher Scientific Cat#: 21565 1.5M Tris-Hcl (ph8.8) Solarbio Cat#: T1010 1.0M Tris-Hcl (ph6.8) Solarbio Cat#: T1020 FITC Solarbio Cat#: F8070 Mutanolysin Sigma Cat#: SAE0092 OADC Becton, Dickinson, and Company Cat#: 212351 Experimental models: Cell lines BMDMs This paper N/A RAW264.7 cell Cell Culture Center, Xiehe Medical University Cat#: 1101MOU-PUMC000146 Experimental models: Organisms/strains C57BL6/J SpfBiotech N/A Oligonucleotides mtDloop-2-fwd: AATCTACCATGCTC CGTGAAACC Tsingke N/A mtDloop-2-rev: TCAGTTTAGCTACCCC CAAGTTTAA Tsingke N/A β-actin-fwd: CCTTCTGACCCATTCCCACC Tsingke N/A β-actin-rev: GCTTCTTTGCAGCTCCTTCG Tsingke N/A Recombinant DNA PET-(28a+)-ESAT6 This paper N/A Software and algorithms FlowJo version 10.2 BD Biosciences https://docs.flowjo.com/flowjo/getting- acquainted/10-2-release-notes/ NIS-Elements Viewer 5.21 64-bit Nikon https://www.microscope.healthcare.nikon. com/products/software/nis-elements/ software-resources GraphPad Prism 8 GraphPad https://www.graphpad.com/features ImageJ NIH N/A 16 Cell Reports 44, 116421, October 28, 2025 We used RAW264.7 in the present experiments were obtained from Cell Culture Center, Xiehe Medical University (Beijing China). ..
Software:Article Title: Mycobacterium bovis induces macrophage mitochondrial release of hexokinase 2 to enhance intracellular survival.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER VBIT-4 Targetmol Cat#: 2086257-77-2 EGS ThermoFisher Scientific Cat#: 21565 1.5M Tris-Hcl (ph8.8) Solarbio Cat#: T1010 1.0M Tris-Hcl (ph6.8) Solarbio Cat#: T1020 FITC Solarbio Cat#: F8070 Mutanolysin Sigma Cat#: SAE0092 OADC Becton, Dickinson, and Company Cat#: 212351 Experimental models: Cell lines BMDMs This paper N/A RAW264.7 cell Cell Culture Center, Xiehe Medical University Cat#: 1101MOU-PUMC000146 Experimental models: Organisms/strains C57BL6/J SpfBiotech N/A Oligonucleotides mtDloop-2-fwd: AATCTACCATGCTC CGTGAAACC Tsingke N/A mtDloop-2-rev: TCAGTTTAGCTACCCC CAAGTTTAA Tsingke N/A β-actin-fwd: CCTTCTGACCCATTCCCACC Tsingke N/A β-actin-rev: GCTTCTTTGCAGCTCCTTCG Tsingke N/A Recombinant DNA PET-(28a+)-ESAT6 This paper N/A Software and algorithms FlowJo version 10.2 BD Biosciences https://docs.flowjo.com/flowjo/getting- acquainted/10-2-release-notes/ NIS-Elements Viewer 5.21 64-bit Nikon https://www.microscope.healthcare.nikon. com/products/software/nis-elements/ software-resources GraphPad Prism 8 GraphPad https://www.graphpad.com/features ImageJ NIH N/A 16 Cell Reports 44, 116421, October 28, 2025 We used RAW264.7 in the present experiments were obtained from Cell Culture Center, Xiehe Medical University (Beijing China). ..
|
TargetMol is a verified supplier 
TargetMol manufactures this product 